A carboxy-subterminal aromatic residue in Schizophyllum commune mating pheromones controls specific recognition by Bar4 receptor
Thomas Fowler
Department of Biological Sciences, Southern Illinois University Edwardsville, Edwardsville, IL 62026; tfowler@siue.edu
Fungal Genetics Reports 57:4-6 (pdf)
Most heterothallic basidiomycetes use small lipopeptide pheromones as part of mate recognition. Schizophyllum commune has scores of pheromones that must be specifically recognized by mating receptors. A correlation between a phenylalanine residue near the C-terminus of several pheromones and the ability of those pheromones to activate receptor Bar4 was recognized. We hypothesized that the phenylalanine residue would be critical for Bar4 activation and tested the hypothesis by making site-directed mutant pheromones and testing these pheromone variants in matings. The data support the hypothesis and add to our understanding of which amino acid residues within pheromones are critical for specific recognition by pheromone receptors.
Many of the Agaricomycotina fungi express quite a few mating pheromones and seven-transmembrane-domain pheromone receptors (most recently reviewed by Raudaskoski and Kothe, 2010). A large number of lipopeptide mating pheromones are coded species-wide by Schizophyllum commune, but any individual has genes for only a small subset of the species’ estimated 80–100 pheromones. More than twenty of the genes that encode these pheromones have been cloned and sequenced (for list and references, see Table 3 in Fowler et al., 2004). One attempt at classifying these pheromones placed them into five groups according to similarity of the predicted mature pheromones’ amino acid sequences (Fowler et al., 2004). The subsets of receptors activated by the pheromones follow a pattern that closely correlates with pheromone groups arranged by sequence similarity. Three pheromone groups (III, IV,V) arranged by similarity activate three completely distinct sets of receptors. The remaining two pheromone groups (I and II) also had corresponding receptors that were distinctly activated only by pheromones within their respective groups, with one exception: pheromone receptor Bar4 is activated by pheromone Bap3(1) from group I and by pheromones Bap3(3) and Bbp2(6) from group II (Table 1). Comparison of the amino acid sequences of group I and II pheromones showed that all five group I pheromones had tryptophan (W) in the carboxy-subterminal position except pheromone Bap3(1), which has phenylalanine (F) in the carboxy-subterminal position and can activate receptor Bar4. Both group II pheromones also have F in the carboxy-subterminal position. For all seven wild-type pheromones of groups I and II that have been characterized, pheromones with F in the carboxy-subterminal position can activate Bar4 and pheromones with W in that position cannot activate Bar4 (Fowler et al., 2004). We wondered if that single F residue could be the key to recognition as an activating ligand by Bar4. In other tests for critical amino acid residues within fungal lipopeptide mating pheromones, single amino acids have been crucial. One amino acid in a pheromone can determine activation or failure of activation of a receptor, or produce activity with a different receptor without losing the original pheromone activity (Olesnicky et al., 2000; Fowler et al., 2001). We are interested in the rules and patterns that govern pheromone and pheromone receptor interactions.
Table 1. Wild-type and mutant pheromone sequences and activities
Group Name Predicted Pheromone1 Receptors Activated2
Wild-type pheromones
I Bap3(1) ERVGTGGTATAFC Bar2, Bar4, Bar5
II Bap3(3) ERHGSGNMTYFC Bar4, Bar7, Bbr8
II Bbp2(6) EREGDGNMTYFC Bar4, Bar7, Bbr8
I Bap1(1)r EREGGSDCTAWC Bar2, Bar3, Bar5, Bar6
Mutant pheromones
I Bap3(1)F54Y ERVGTGGTATAYC Bar2, Bar4, Bar5
I Bap3(1)F54W ERVGTGGTATAWC Bar2, Bar5
I Bap1(1)rW30F EREGGSDCTAFC Bar2, Bar3, Bar4, Bar5
1All pheromones of S. commune are cleaved from larger precursors and are predicted to be carboxymethylated and farnesylated on the C-terminal cysteine residue (see review of Raudaskoski and Kothe, 2010).
2Receptors Bar1 though Bar9 were each tested individually. Tester strains in order from Bar1 to Bar9 were: V151-20, T26, V160-21, V147-1, V112-17, V123-29, V119-19, V142-3, V118-7. Addition Bar4 tester V131-5 was also used.
To test whether the subterminal F is a key residue for Bar4 activation by pheromones from groups I and II, site-directed changes in codons for the subterminal residues, codons 30 and 54, were made in two pheromone genes, bap1(1)r and bap3(1), respectively, using the Quik-change oligonucleotide-based site-directed mutagenesis kit (Stratagene, La Jolla, CA; Kothe, 1999; Fowler et al., 2004). Oligonucleotide primers used in this study are shown in Table 2. The plasmid templates for mutagenesis, containing a genomic copy of a wild-type pheromone gene, were pTF9045-12 [bap3(1)] and pTF9073-2 [bap1(1)r] (Fowler et al., 2004). Mutagenesis of the genes was confirmed by DNA sequencing across the mutagenized sites (University of Illinois Urbana-Champaign Core Sequencing Facility). Several new pheromones were produced from these altered genes. Each mutant pheromone has a single amino acid difference at the carboxy-subterminal amino acid position compared to its wild-type progenitor. A tryptophan auxotrophic strain of S. commune (V201-106, trp1-, ΔB-MAT; FGSC#9350), which has no endogenous mating pheromone or receptor activity due to a large deletion in the B-MAT locus (Raper and Raper, 1973; Fowler et al., 1998), was co-transformed with two plasmids, one containing the pheromone gene to be tested and the second containing wild-type trp1 (pRHV1, Horton and Raper, 1995). Protoplasts were generated for transformation with Novozyme 234 and transformed by a PEG-mediated method (Specht et al.; 1988 Horton and Raper, 1991), using 20 ug of the pheromone gene plasmid and 10 ug of pRHV1. Co-transformants were identified through selection on CYM agar lacking tryptophan (Raper and Hoffman, 1974) followed by test matings with S. commune strains V160-21 (Bar3) and T26 (Bar2) to identify pheromone activation by the transformants. Those tryptophan prototrophic colonies that could convert either test mate to a dikaryon, indicating they were producing a pheromone, were saved and used in further matings with additional tester strains that represented each of the nine Bars (B-MATα receptors), including Bar4 (Fowler et al., 2004). Table 1 reports the sequences and activities of the wild-type and mutant pheromones. A minimum of three independent transformants of each pheromone gene was tested.
The data in Table 1 support the hypothesis that F plays a critical positive role for activation of Bar4. The mutant pheromone Bap3(1)F54Y also extends the range of possible residues in the subterminal position by showing that Bar4 responds if tyrosine (Y) is in the carboxy-subterminal position. However, like four previously characterized wild-type group I pheromones including Bap1(1)r (Fowler et al., 2004), if a mutant Bap3(1) has a subterminal tryptophan [Bap3(1)F54W], then Bar4 is not activated. In a second test of the effectiveness of pheromones with subterminal F to initiate signaling through Bar4, Bap1(1)r was altered from a wild-type pheromone that has W in the subterminal position and does not stimulate Bar4 to the mutant Bap1(1)rW30F that can activate Bar4. Additionally, we note that Bap1(1)r is affected by the mutational change with regard to Bar6, but in an opposite manner to Bar4. Bar6 activation appears dependent on W in the carboxy-subterminal position of Bap1(1)r and does not tolerate F in that position [Bap1(1)rW30F]. In no case did altering a pheromone to a different aromatic residue at the carboxy-subterminal position result in a completely inactive pheromone.
Extrapolating from the activity range of characterized wild-type pheromones and the interfertility of S. commune, each version of B-MAT must produce a suite of pheromones that collectively can activate all non-self mating receptors, including some pheromones with partially redundant activities. This arrangement maintains a high potential for outbreeding in the species. In this mutagenesis study, we have identified the functional importance of aromatic residues in the carboxy-subterminal position of pheromones in groups I and II. The gene for receptor Bar4 has not yet been isolated. It will be interesting to determine how similar Bar4 is to the pheromone receptors that recognize either group I or group II pheromones, but not both.
Table 2. Oligonucleotides used for site-directed mutagenesis
Name Oligonucleotide sequence1 Mutant pheromone produced
060905-1 GGTACTGCGACCGCCTGGTGCGTTGTCGCATGAG Bap3(1)F54W
060905-2 CTCATGCGACAACGCACCAGGCGGTCGCAGTACC Bap3(1)F54W
060905-3 GGTACTGCGACCGCCTACTGCGTTGTCGCATGAG Bap3(1)F54Y
060912-1 CTCATGCGACAACGCAGTAGGCGGTCGCAGTACC Bap3(1)F54Y
060905-5 CTCTGACTGCACGGCGTTTTGTGTGGTGGCGTAG Bap1(1)rW30F
060905-6 CTACGCCACCACACAAAACGCCGTGCAGTCAGAG Bap1(1)rW30F
1Codon change is shown in bold. Primers are used in consecutive pairs.
Acknowledgments
This research was supported by NSF grant MCB0606700 and SIUE Assigned Time for Research Award. Technical assistance from Melanie Troxell and Lori Miller is gratefully recognized.
References
Fowler, T.J., Mitton, M.F., and Raper, C.A.. 1998. Gene mutations affecting specificity of pheromone/receptor mating interactions in Schizophyllum commune. Proceedings of the Fourth Meeting on the Genetics and Cellular Biology of Basidiomycetes, pp. 130-134, Nijmegen, The Netherlands.
Fowler, T.J., Mitton, M.F., Vaillancourt, L.J., and Raper, C.A. 2001. Changes in mate recognition through alterations of pheromones and receptors in the multisexual mushroom fungus Schizophyllum commune. Genetics 158: 1491–1503.
Fowler, T.J., Mitton, M.F, Rees, E.I. and Raper, C.A. 2004. Crossing the boundary between the Bα and Bβ mating-type loci in Schizophyllum commune. Fungal Genet. Biol. 41:89-101.
Horton, J.S., and Raper, C.A. 1991. A mushroom-inducing DNA sequence isolated from the basidiomycete, Schizophyllum commune. Genetics 129:707-716.
Horton, J.S., and Raper, C.A. 1995. The mushroom-inducing gene Frt1 of Schizophyllum commune encodes a putative nucleotide binding protein. Mol. Gen. Genet. 247:358-366.
Kothe, E. 1999. Mating types and pheromone recognition in the homobasidiomycete Schizophyllum commune. Fungal Genet. Biol. 27:146-152.
Olesnicky, N.S., Brown, A.J., Honda, Y., Dyos, S.L., Dowell, S.J., and Casselton, L.A. 2000. Self-compatible B mutants in Coprinus with altered pheromone–receptor specificities. Genetics 156: 1025–1033.
Raper, C.A. and Raper, J.R. 1973. Mutational analysis of a regulatory gene for morphogenesis in Schizophyllum. Proc. Natl. Acad. Sci. USA 70:1427-1431.
Raper, J.R. and Hoffman, R.M. 1974. Schizophyllum commune, pp.597-626 in Handbook of Genetics, R.C. King, ed., Plenum Press, New York.
Raudaskoski, M. and Kothe, E. 2010. Basidiomycete mating type genes and pheromone signaling. Euk. Cell doi:10.1128/EC.00319-09, published ahead of print 26 Feb 2010.
Specht, C.A., Munoz-Rivas, A., Novotny, C.P., and Ullrich, R.C. 1988. Transformation of Schizophyllum commune: an analysis of parameters for improving transformation frequencies. Exper. Mycol. 12:357-366.